Jan-11 07:32:06.878 [main] DEBUG nextflow.cli.Launcher - $> nextflow run nf-core/eager -r 2.2.2 --help Jan-11 07:32:07.101 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0 Jan-11 07:32:09.774 [main] DEBUG nextflow.scm.AssetManager - Git config: /home/ibar/.nextflow/assets/nf-core/eager/.git/config; branch: master; remote: origin; url: https://github.com/nf-core/eager.git Jan-11 07:32:09.800 [main] DEBUG nextflow.scm.AssetManager - Git config: /home/ibar/.nextflow/assets/nf-core/eager/.git/config; branch: master; remote: origin; url: https://github.com/nf-core/eager.git Jan-11 07:32:10.220 [main] INFO nextflow.cli.CmdRun - Launching `nf-core/eager` [focused_celsius] - revision: 85e2e3288a [2.2.2] Jan-11 07:32:11.671 [main] DEBUG nextflow.config.ConfigBuilder - Found config base: /home/ibar/.nextflow/assets/nf-core/eager/nextflow.config Jan-11 07:32:11.672 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /home/ibar/.nextflow/assets/nf-core/eager/nextflow.config Jan-11 07:32:11.684 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard` Jan-11 07:32:13.843 [main] DEBUG nextflow.Session - Session uuid: 9c7192b3-221f-4a0f-95be-3a091b847c78 Jan-11 07:32:13.844 [main] DEBUG nextflow.Session - Run name: focused_celsius Jan-11 07:32:13.845 [main] DEBUG nextflow.Session - Executor pool size: 2 Jan-11 07:32:13.868 [main] DEBUG nextflow.cli.CmdRun - Version: 20.10.0 build 5430 Created: 01-11-2020 15:14 UTC (02-11-2020 01:14 AEDT) System: Linux 3.10.0-693.5.2.el7.x86_64 Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 1.8.0_265-b11 Encoding: UTF-8 (UTF-8) Process: 140851@awoonga1.local [10.120.50.11] CPUs: 2 - Mem: 251.6 GB (10.5 GB) - Swap: 1000 MB (993.9 MB) Jan-11 07:32:13.891 [main] DEBUG nextflow.Session - Work-dir: /gpfs1/scratch/30days/ibar/data/Dingo/Dingo_aDNA_NF2_process_10_01_2021/work [gpfs] Jan-11 07:32:13.975 [main] DEBUG nextflow.Session - Observer factory: TowerFactory Jan-11 07:32:13.978 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory Jan-11 07:32:14.291 [main] DEBUG nextflow.Session - Session start invoked Jan-11 07:32:14.297 [main] DEBUG nextflow.trace.TraceFileObserver - Flow starting -- trace file: /gpfs1/scratch/30days/ibar/data/Dingo/Dingo_aDNA_NF2_process_10_01_2021/results/pipeline_info/execution_trace.txt Jan-11 07:32:20.564 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution Jan-11 07:32:20.574 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: library_merge, genotyping_hc, output_documentation, eigenstrat_snp_coverage, nuclear_contamination, makeFastaIndex, convertBam, multivcfanalyzer, mtnucratio, genotyping_freebayes, lanemerge_hostremoval_fastq, hostremoval_input_fastq, makeSeqDict, genotyping_ug, makeBT2Index, bowtie2, adapter_removal, maltextract, bwa, malt, genotyping_angsd, kraken, vcf2genome, samtools_flagstat, unzip_reference, sex_deterrmine, bedtools, damageprofiler, seqtype_merge, fastqc_after_clipping, circularmapper, preseq, genotyping_pileupcaller, kraken_parse, samtools_flagstat_after_filter, indexinputbam, bam_trim, samtools_filter, print_nuclear_contamination, get_software_versions, bwamem, additional_library_merge, circulargenerator, multiqc, fastp, endorSpy, qualimap, kraken_merge, decomp_kraken, lanemerge, dedup, pmdtools, fastqc, makeBWAIndex, markduplicates Jan-11 07:32:20.599 [main] INFO nextflow.Nextflow - ---------------------------------------------------- ,--./,-.  ___ __ __ __ ___ /,-._.--~'  |\ | |__ __ / ` / \ |__) |__ } {  | \| | \__, \__/ | \ |___ \`-._,-`-, `._,._,'  nf-core/eager v2.2.2 ---------------------------------------------------- Jan-11 07:32:20.606 [main] INFO nextflow.Nextflow - ========================================= eager v2.2.2 ========================================= Usage: The typical command for running the pipeline is as follows: nextflow run nf-core/eager -profile --reads'*_R{1,2}.fastq.gz' --fasta '.fasta' Mandatory arguments: -profile [str] Configuration profile to use. Can use multiple (comma separated). Ask system administrator if unsure. Available: conda, docker, singularity, test, awsbatch, and more Input --input [file] Either paths or URLs to FASTQ/BAM data (must be surrounded with quotes). Indicate multiple files with wildcards (*). For paired end data, the path must use '{1,2}' notation to specify read pairs. OR A path to a TSV file (ending .tsv) containing file paths and sequencing/sample metadata. Allows for merging of multiple lanes/libraries/samples. Please see documentation for template. --udg_type [str] Specify here if you have UDG treated libraries, Set to 'half' for partial treatment, or 'full' for UDG. If not set, libraries are assumed to have no UDG treatment ('none'). Not required for TSV input. Default: none --single_stranded [bool] Specifies that libraries are single stranded. Only effects MaltExtract and genotyping pileupCaller. Not required for TSV input. --single_end [bool] Specifies that the input is single end reads. Not required for TSV input. --colour_chemistry [num] Specifies what Illumina sequencing chemistry was used. Used to inform whether to poly-G trim if turned on (see below). Not required for TSV input. Options: 2, 4. Default: 4 --bam [bool] Specifies that the input is in BAM format. Not required for TSV input. Additional Options: --snpcapture_bed [file] If library result of SNP capture, path to BED file containing SNPs positions on reference genome. --run_convertinputbam [bool] Turns on conversion of an input BAM file into FASTQ format to allow re-preprocessing (e.g. AdapterRemoval etc.). References --fasta [file] Path or URL to a FASTA reference file (required if not iGenome reference). File suffixes can be: '.fa', '.fn', '.fna', '.fasta' --genome [str] Name of iGenomes reference (required if not FASTA reference). --bwa_index [dir] Path to directory containing pre-made BWA indices (i.e. everything before the endings '.amb' '.ann' '.bwt'. Most likely the same path as --fasta). If not supplied will be made for you. --bt2_index [dir] Path to directory containing pre-made Bowtie2 indices (i.e. everything before the endings e.g. '.1.bt2', '.2.bt2', '.rev.1.bt2'. Most likely the same value as --fasta). If not supplied will be made for you. --fasta_index [file] Path to samtools FASTA index (typically ending in '.fai'). --seq_dict [file] Path to picard sequence dictionary file (typically ending in '.dict'). --large_ref [bool] Specify to generate more recent '.csi' BAM indices. If your reference genome is larger than 3.5GB, this is recommended due to more efficient data handling with the '.csi' format over the older '.bai'. --save_reference [bool] Turns on saving reference genome indices for later re-usage. Output options: --outdir [dir] The output directory where the results will be saved. Default: ./results -w [dir] The directory where intermediate files will be stored. Recommended: '/work/' Skipping Skip any of the mentioned steps. --skip_fastqc [bool] Skips both pre- and post-Adapter Removal FastQC steps. --skip_adapterremoval [bool] --skip_preseq [bool] --skip_deduplication [bool] --skip_damage_calculation [bool] --skip_qualimap [bool] Complexity Filtering --complexity_filter_poly_g [bool] Turn on running poly-G removal on FASTQ files. Will only be performed on 2 colour chemistry machine sequenced libraries. --complexity_filter_poly_g_min [num] Specify length of poly-g min for clipping to be performed. Default: 10 Clipping / Merging --clip_forward_adaptor [str] Specify adapter sequence to be clipped off (forward strand). Default: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' --clip_reverse_adaptor [str] Specify adapter sequence to be clipped off (reverse strand). Default: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA' --clip_readlength [num] Specify read minimum length to be kept for downstream analysis. Default: 30 --clip_min_read_quality [num] Specify minimum base quality for trimming off bases. Default: 20 --min_adap_overlap [num] Specify minimum adapter overlap: Default: 1 --skip_collapse [bool] Skip merging forward and reverse reads together. Only applicable for paired-end libraries. --skip_trim [bool] Skip adapter and quality trimming --preserve5p [bool] Skip 5p quality base trimming (n, score, window) of 5 prime end. --mergedonly [bool] Only use merged reads downstream (un-merged reads and singletons are discarded). Mapping --mapper [str] Specify which mapper to use. Options: 'bwaaln', 'bwamem', 'circularmapper', 'bowtie2'. Default: 'bwaaln' --bwaalnn [num] Specify the -n parameter for BWA aln, i.e. amount of allowed mismatches in alignments. Default: 0.04 --bwaalnk [num] Specify the -k parameter for BWA aln, i.e. maximum edit distance allowed in a seed. Default: 2 --bwaalnl [num] Specify the -l parameter for BWA aln, i.e. length of seeds to be used. Set to 1024 for whole read. Default: 1024 --circularextension [num] Specify the number of bases to extend reference by (circularmapper only). Default: 500 --circulartarget [chr] Specify the FASTA header of the target chromosome to extend(circularmapper only). Default: 'MT' --circularfilter [bool] Turn on to filter off-target reads (circularmapper only). --bt2_alignmode [str] Specify the bowtie2 alignment mode. Options: 'local', 'end-to-end'. Default: 'local' --bt2_sensitivity [str] Specify the level of sensitivity for the bowtie2 alignment mode. Options: 'no-preset', 'very-fast', 'fast', 'sensitive', 'very-sensitive'. Default: 'sensitive' --bt2n [num] Specify the -N parameter for bowtie2 (mismatches in seed). This will override defaults from alignmode/sensitivity. Default: 0 --bt2l [num] Specify the -L parameter for bowtie2 (length of seed substrings). This will override defaults from alignmode/sensitivity. Default: 0 --bt2_trim5 [num] Specify number of bases to trim off from 5' (left) end of read before alignment. Default: 0 --bt2_trim3 [num] Specify number of bases to trim off from 3' (right) end of read before alignment. Default: 0 Host removal --hostremoval_input_fastq [bool] Turn on creating pre-Adapter Removal FASTQ files without reads that mapped to reference (e.g. for public upload of privacy sensitive non-host data) --hostremoval_mode [str] Host DNA Removal mode. Remove mapped reads completely from FASTQ (remove) or just mask mapped reads sequence by N (replace). Default: 'remove' BAM Filtering --run_bam_filtering [bool] Turn on filtering of mapping quality, read lengths, or unmapped reads of BAM files. --bam_mapping_quality_threshold [num] Minimum mapping quality for reads filter. Default: 0 --bam_filter_minreadlength [num] Specify minimum read length to be kept after mapping. --bam_unmapped_type [str] Defines whether to discard all unmapped reads, keep both mapped and unmapped together, or save as bam and/or only fastq format Options: 'discard', 'bam', 'keep', 'fastq', 'both'. Default: 'discard' DeDuplication --dedupper [str] Deduplication method to use. Options: 'markduplicates', 'dedup'. Default: 'markduplicates' --dedup_all_merged [bool] Turn on treating all reads as merged reads. Library Complexity Estimation --preseq_step_size [num] Specify the step size of Preseq. Default: 1000 (aDNA) Damage Analysis --damageprofiler_length [num] Specify length filter for DamageProfiler. Default: 100 --damageprofiler_threshold [num] Specify number of bases of each read to consider for DamageProfiler calculations. Default: 15 --damageprofiler_yaxis [float] Specify the maximum misincorporation frequency that should be displayed on damage plot. Set to 0 to 'autoscale'. Default: 0.30 --run_pmdtools [bool] Turn on PMDtools --pmdtools_range [num] Specify range of bases for PMDTools. Default: 10 --pmdtools_threshold [num] Specify PMDScore threshold for PMDTools. Default: 3 --pmdtools_reference_mask [file] Specify a path to reference mask for PMDTools. --pmdtools_max_reads [num] Specify the maximum number of reads to consider for metrics generation. Default: 10000 Annotation Statistics --run_bedtools_coverage [bool] Turn on ability to calculate no. reads, depth and breadth coverage of features in reference. --anno_file [file] Path to GFF or BED file containing positions of features in reference file (--fasta). Path should be enclosed in quotes. BAM Trimming --run_trim_bam [bool] Turn on BAM trimming. Will only run on full-UDG or half-UDG libraries. --bamutils_clip_half_udg_left [num] Specify the number of bases to clip off reads from 'left' end of read for half-UDG libraries. Default: 1 --bamutils_clip_half_udg_right [num] Specify the number of bases to clip off reads from 'right' end of read for half-UDG libraries. Default: 1 --bamutils_clip_none_udg_left [num] Specify the number of bases to clip off reads from 'left' end of read for non-UDG libraries. Default: 1 --bamutils_clip_none_udg_right [num] Specify the number of bases to clip off reads from 'right' end of read for non-UDG libraries. Default: 1 --bamutils_softclip [bool] Turn on using softclip instead of hard masking. Genotyping --run_genotyping [bool] Turn on genotyping of BAM files. --genotyping_tool [str] Specify which genotyper to use either GATK UnifiedGenotyper, GATK HaplotypeCaller, Freebayes, or pileupCaller. Options: 'ug', 'hc', 'freebayes', 'pileupcaller', 'angsd'. --genotyping_source [str] Specify which input BAM to use for genotyping. Options: 'raw', 'trimmed' or 'pmd'. Default: 'raw' --gatk_call_conf [num] Specify GATK phred-scaled confidence threshold. Default: 30 --gatk_ploidy [num] Specify GATK organism ploidy. Default: 2 --gatk_downsample [num] Maximum depth coverage allowed for genotyping before down-sampling is turned on. Default: 250 --gatk_dbsnp [file] Specify VCF file for output VCF SNP annotation. Optional. Gzip not accepted. --gatk_hc_out_mode [str] Specify GATK output mode. Options: 'EMIT_VARIANTS_ONLY', 'EMIT_ALL_CONFIDENT_SITES', 'EMIT_ALL_ACTIVE_SITES'. Default: 'EMIT_VARIANTS_ONLY' --gatk_hc_emitrefconf [str] Specify HaplotypeCaller mode for emitting reference confidence calls . Options: 'NONE', 'BP_RESOLUTION', 'GVCF'. Default: 'GVCF' --gatk_ug_out_mode [str] Specify GATK output mode. Options: 'EMIT_VARIANTS_ONLY', 'EMIT_ALL_CONFIDENT_SITES', 'EMIT_ALL_SITES'. Default: 'EMIT_VARIANTS_ONLY' --gatk_ug_genotype_model [str] Specify UnifiedGenotyper likelihood model. Options: 'SNP', 'INDEL', 'BOTH', 'GENERALPLOIDYSNP', 'GENERALPLOIDYINDEL'. Default: 'SNP' --gatk_ug_keep_realign_bam [bool] Specify to keep the BAM output of re-alignment around variants from GATK UnifiedGenotyper. --gatk_ug_defaultbasequalities [num] Supply a default base quality if a read is missing a base quality score. Setting to -1 turns this off. --freebayes_C [num] Specify minimum required supporting observations to consider a variant. Default: 1 --freebayes_g [num] Specify to skip over regions of high depth by discarding alignments overlapping positions where total read depth is greater than specified in --freebayes_C. Default: 0 --freebayes_p [num] Specify ploidy of sample in FreeBayes. Default: 2 --pileupcaller_bedfile [file] Specify path to SNP panel in bed format for pileupCaller. --pileupcaller_snpfile [file] Specify path to SNP panel in EIGENSTRAT format for pileupCaller. --pileupcaller_method [str] Specify calling method to use. Options: 'randomHaploid', 'randomDiploid', 'majorityCall'. Default: 'randomHaploid' --pileupcaller_transitions_mode [str] Specify the calling mode for transitions. Options: 'AllSites', 'TransitionsMissing', 'SkipTransitions'. Default: 'AllSites' --angsd_glmodel [str] Specify which ANGSD genotyping likelihood model to use. Options: 'samtools', 'gatk', 'soapsnp', 'syk'. Default: 'samtools' --angsd_glformat [str] Specify which output type to output ANGSD genotyping likelihood results: Options: 'text', 'binary', 'binary_three', 'beagle'. Default: 'binary' --angsd_createfasta [bool] Turn on creation of FASTA from ANGSD genotyping likelhoood. --angsd_fastamethod [str] Specify which genotype type of 'base calling' to use for ANGSD FASTA generation. Options: 'random', 'common'. Default: 'random' Consensus Sequence Generation --run_vcf2genome [bool] Turns on ability to create a consensus sequence FASTA file based on a UnifiedGenotyper VCF file and the original reference (only considers SNPs). --vcf2genome_outfile [str] Specify name of the output FASTA file containing the consensus sequence. Do not include `.vcf` in the file name. Default: '' --vcf2genome_header [str] Specify the header name of the consensus sequence entry within the FASTA file. Default: '' --vcf2genome_minc [num] Minimum depth coverage required for a call to be included (else N will be called). Default: 5 --vcf2genome_minq [num] Minimum genotyping quality of a call to be called. Else N will be called. Default: 30 --vcf2genome_minfreq [float] Minimum fraction of reads supporting a call to be included. Else N will be called. Default: 0.8 SNP Table Generation --run_multivcfanalyzer [bool] Turn on MultiVCFAnalyzer. Note: This currently only supports diploid GATK UnifiedGenotyper input. --write_allele_frequencies [bool] Turn on writing write allele frequencies in the SNP table. --min_genotype_quality [num] Specify the minimum genotyping quality threshold for a SNP to be called. Default: 30 --min_base_coverage [num] Specify the minimum number of reads a position needs to be covered to be considered for base calling. Default: 5 --min_allele_freq_hom [float] Specify the minimum allele frequency that a base requires to be considered a 'homozygous' call. Default: 0.9 --min_allele_freq_het [float] Specify the minimum allele frequency that a base requires to be considered a 'heterozygous' call. Default: 0.9 --additional_vcf_files [file] Specify paths to additional pre-made VCF files to be included in the SNP table generation. Use wildcard(s) for multiple files. Optional. --reference_gff_annotations [file] Specify path to the reference genome annotations in '.gff' format. Optional. --reference_gff_exclude [file] Specify path to the positions to be excluded in '.gff' format. Optional. --snp_eff_results [file] Specify path to the output file from SNP effect analysis in '.txt' format. Optional. Mitochondrial to Nuclear Ratio --run_mtnucratio [bool] Turn on mitochondrial to nuclear ratio calculation. --mtnucratio_header [str] Specify the name of the reference FASTA entry corresponding to the mitochondrial genome (up to the first space). Default: 'MT' Sex Determination --run_sexdeterrmine [bool] Turn on sex determination for human reference genomes. --sexdeterrmine_bedfile [file] Specify path to SNP panel in bed format for error bar calculation. Optional (see documentation). Nuclear Contamination for Human DNA --run_nuclear_contamination [bool] Turn on nuclear contamination estimation for human reference genomes. --contamination_chrom_name [str] The name of the X chromosome in your bam or FASTA header. 'X' for hs37d5, 'chrX' for HG19. Default: 'X' Metagenomic Screening --run_metagenomic_screening [bool] Turn on metagenomic screening module for reference-unmapped reads --metagenomic_tool [str] Specify which classifier to use. Options: 'malt', 'kraken'. Default: 'X' --database [dir] Specify path to classifer database directory. For Kraken2 this can also be a `.tar.gz` of the directory. --metagenomic_min_support_reads [num] Specify a minimum number of reads a taxon of sample total is required to have to be retained. Not compatible with . Default: 1 --percent_identity [num] Percent identity value threshold for MALT. Default: 85 --malt_mode [str] Specify which alignment method to use for MALT. Options: 'Unknown', 'BlastN', 'BlastP', 'BlastX', 'Classifier'. Default: 'BlastN' --malt_alignment_mode [str] Specify alignment method for MALT. Options: 'Local', 'SemiGlobal'. Default: 'SemiGlobal' --malt_top_percent [num] Specify the percent for LCA algorithm for MALT (see MEGAN6 CE manual). Default: 1 --malt_min_support_mode [str] Specify whether to use percent or raw number of reads for minimum support required for taxon to be retained for MALT. Options: 'percent', 'reads'. Default: 'percent' --malt_min_support_percent [num] Specify the minimum percentage of reads a taxon of sample total is required to have to be retained for MALT. Default: Default: 0.01 --malt_max_queries [num] Specify the maximium number of queries a read can have for MALT. Default: 100 --malt_memory_mode [str] Specify the memory load method. Do not use 'map' with GPFS file systems for MALT as can be very slow. Options: 'load', 'page', 'map'. Default: 'load' --malt_sam_output [bool] Specify to also produce SAM alignment files. Note this includes both aligned and unaligned reads, and are gzipped. Note this will result in very large file sizes. Metagenomic Authentication --run_maltextract [bool] Turn on MaltExtract for MALT aDNA characteristics authentication --maltextract_taxon_list [file] Path to a txt file with taxa of interest (one taxon per row, NCBI taxonomy name format) --maltextract_ncbifiles [dir] Path to directory containing containing NCBI resource files (ncbi.tre and ncbi.map; avaliable: https://github.com/rhuebler/HOPS/) --maltextract_filter [str] Specify which MaltExtract filter to use. Options: 'def_anc', 'ancient', 'default', 'crawl', 'scan', 'srna', 'assignment'. Default: 'def_anc' --maltextract_toppercent [num] Specify percent of top alignments to use. Default: 0.01 --maltextract_destackingoff [bool] Turn off destacking. --maltextract_downsamplingoff [bool] Turn off downsampling. --maltextract_duplicateremovaloff [bool] Turn off duplicate removal. --maltextract_matches [bool] Turn on exporting alignments of hits in BLAST format. --maltextract_megansummary [bool] Turn on export of MEGAN summary files. --maltextract_percentidentity [num] Minimum percent identity alignments are required to have to be reported. Recommended to set same as MALT parameter. Default: 85.0 --maltextract_topalignment [int] Turn on using top alignments per read after filtering. Other options: -name [str] Name for the pipeline run. If not specified, Nextflow will automatically generate a random mnemonic. --max_memory [str] Memory limit for each step of pipeline. Should be in form e.g. --max_memory '8.GB'. Default: '128 GB' --max_time [str] Time limit for each step of the pipeline. Should be in form e.g. --max_time '2.h'. Default: '10d' --max_cpus [str] Maximum number of CPUs to use for each step of the pipeline. Should be in form e.g. Default: '16' --publish_dir_mode [str] Mode for publishing results in the output directory. Available: symlink, rellink, link, copy, copyNoFollow, move. Default: 'copy' --email [email] Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits --email_on_fail [email] Same as --email, except only send mail if the workflow is not successful --plaintext_email [email] Receive plain text emails rather than HTML --max_multiqc_email_size [str] Threshold size for MultiQC report to be attached in notification email. If file generated by pipeline exceeds the threshold, it will not be attached (Default: 25MB) AWSBatch options: --awsqueue [str] The AWSBatch JobQueue that needs to be set when running on AWSBatch --awsregion [str] The AWS Region for your AWS Batch job to run on --awscli [str] Path to the AWS CLI tool For a full list and more information of available parameters, consider the documentation (https://github.com/nf-core/eager/).