Skip to content

Latest commit

 

History

History
259 lines (185 loc) · 12.1 KB

File metadata and controls

259 lines (185 loc) · 12.1 KB

Build Status

dswfFakeFASTQ

Generate a FASTQ file for testing the Duplex-Sequencing workflow

Creates two paired-end FASTQ files or one FASTQ file for testing the Duplex-Sequencing workflow.

Only requires a FASTA file of the read sequence to use to generate the FASTQ file, but has many options that allow customization of the FASTQ file(s) created.

``usage: makeFakeFASTQ.py [-h] [--barcode_length BARCODE_LENGTH]
[--barcode_a BARCODE_A] [--barcode_b BARCODE_B] [--spacer_length SPACER_LENGTH] [--max_num_families MAX_NUM_FAMILIES] [--min_num_families MIN_NUM_FAMILIES] [--num_families NUM_FAMILIES] [--max_num_reads MAX_NUM_READS] [--min_num_reads MIN_NUM_READS] [--num_reads NUM_READS] [--wobble_reads WOBBLE_READS] [--read_length READ_LENGTH] [--max_num_flipped MAX_NUM_FLIPPED] [--min_num_flipped MIN_NUM_FLIPPED] [--num_flipped NUM_FLIPPED] [--prefix PREFIX] [--instrument INSTRUMENT] [--flow_cell FLOW_CELL] [--x_min X_MIN] [--x_max X_MAX] [--y_min Y_MIN] [--y_max Y_MAX] [--lane_min LANE_MIN] [--lane_max LANE_MAX] [--quality_type {high,medium,low}] [--swathes SWATHES [SWATHES ...]] [--tile_min TILE_MIN] [--tile_max TILE_MAX] [--paired_end PAIRED_END] [--is_filtered IS_FILTERED] --fasta [FASTA] [--include_fasta_header_in_fastq_header INCLUDE_FASTA_HEADER_IN_FASTQ_HEADER] [--include_barcode_in_fastq_header INCLUDE_BARCODE_IN_FASTQ_HEADER] [--map_file MAP_FILE] [--frequencies_file [FREQUENCIES_FILE]] [--buffer_end BUFFER_END] [--buffer_both_sides BUFFER_BOTH_SIDES] [--truncate_end TRUNCATE_END] [--truncate_start TRUNCATE_START] [--truncate_both_sides TRUNCATE_BOTH_SIDES] [--truncate_by_read TRUNCATE_BY_READ] [--buffer_seq BUFFER_SEQ] [--quality QUALITY]``
optional arguments:

-h, --help show this help message and exit

--barcode_length BARCODE_LENGTH, -bcl BARCODE_LENGTH
Length of Barcode at beginning and end of sequence. Default: 10
--barcode_a BARCODE_A, -fwbc BARCODE_A
Forward barcode string to use. Default: None
--barcode_b BARCODE_B, -rvbc BARCODE_B
Reverse barcode string to use. Default: None
--spacer_length SPACER_LENGTH, -sl SPACER_LENGTH
Length of Spacer between Barcode and sequence. Default: 1
--max_num_families MAX_NUM_FAMILIES, -maxnf MAX_NUM_FAMILIES
Maximum number of families per molecule.
--min_num_families MIN_NUM_FAMILIES, -minnf MIN_NUM_FAMILIES
Minimum number of families per molecule. Default: 1
--num_families NUM_FAMILIES, -nf NUM_FAMILIES
Number of families per molecule.
--max_num_reads MAX_NUM_READS, -maxnr MAX_NUM_READS
Maximum number of reads per family. Default: 10
--min_num_reads MIN_NUM_READS, -minnr MIN_NUM_READS
Minimum number of reads per family. Default: 1
--num_reads NUM_READS, -nr NUM_READS
Number of reads per family.
--wobble_reads WOBBLE_READS, -wr WOBBLE_READS
Wobble reads to create a distribution
--read_length READ_LENGTH, -rl READ_LENGTH
Length of sequence in FASTQ output. Default: 156
--max_num_flipped MAX_NUM_FLIPPED, -maxnff MAX_NUM_FLIPPED
Maximum number of flipped families per molecule.
--min_num_flipped MIN_NUM_FLIPPED, -minnff MIN_NUM_FLIPPED
Minimum number of flipped familes per molecule. Default: 1
--num_flipped NUM_FLIPPED, -nff NUM_FLIPPED
Number of flipped families per molecule.
--prefix PREFIX, -p PREFIX
Prefix for FASTQ output files. Default: DSWF
--instrument INSTRUMENT, -inst INSTRUMENT
Instrument name in FASTQ reads. Default: NS500770
--flow_cell FLOW_CELL, -fc FLOW_CELL
Flow cell name in FASTQ reads. Default: H5VNJAFXX

--x_min X_MIN Minimum X coordinate for FASTQ read. Default: 1015

--x_max X_MAX Maximum X coordinate for FASTQ read. Default: 26894

--y_min Y_MIN Minimum Y coordinate for FASTQ read. Default: 1017

--y_max Y_MAX Maximum Y coordinate for FASTQ read. Default: 20413

--lane_min LANE_MIN Minimum lane number for FASTQ read

--lane_max LANE_MAX Maximum lane number for FASTQ read

--quality_type {high,medium,low}, -q {high,medium,low}
The quality of sequence: high, medium, low
--swathes SWATHES [SWATHES ...]
The swathes on Illumina chip for FASTQ record Default: [111, 112, 113, 114, 115, 116, 211, 212, 213, 214, 215, 216]

--tile_min TILE_MIN Minimum tile number for FASTQ read

--tile_max TILE_MAX Maximum tile number for FASTQ read

--paired_end PAIRED_END
Produce paired end output. Default: 1
--is_filtered IS_FILTERED
Produce filtered output. List. Default: [N]
--fasta [FASTA], -f [FASTA]
A FASTA file to use as sequence for the reads
--include_fasta_header_in_fastq_header INCLUDE_FASTA_HEADER_IN_FASTQ_HEADER
Include the FASTA header in the FASTQ file after the control
--include_barcode_in_fastq_header INCLUDE_BARCODE_IN_FASTQ_HEADER
Include the family random barcode in the FASTQ file after the control and FASTA header if also selected.
--map_file MAP_FILE Create a map file of molecules to number of families
to number of reads.
--frequencies_file [FREQUENCIES_FILE], -ff [FREQUENCIES_FILE]
File of frequencies for families
--buffer_end BUFFER_END, -be BUFFER_END
Add buffer sequence to end of FASTA line. Default: 1
--buffer_both_sides BUFFER_BOTH_SIDES, -bb BUFFER_BOTH_SIDES
Add buffer sequence to both sides of FASTA line. Default: 0
--truncate_end TRUNCATE_END, -te TRUNCATE_END
Truncate sequence at the end of the FASTA line. Default: 1
--truncate_start TRUNCATE_START, -ts TRUNCATE_START
Truncate sequence at the start of the FASTA line Default: 1
--truncate_both_sides TRUNCATE_BOTH_SIDES, -tbs TRUNCATE_BOTH_SIDES
Truncate both sides of FASTA sequence line. Default: 0
--truncate_by_read TRUNCATE_BY_READ, -tbr TRUNCATE_BY_READ
Truncate paired end 1 reads at end, truncate paired end 2 reads at start. Default: 0
--buffer_seq BUFFER_SEQ, -buffSeq BUFFER_SEQ
Buffer string to use. Default: None
--quality QUALITY, -qual QUALITY
Quality string to use. Default: None

DSWFFakeFASTQ produces a set of paired end FASTQ files with barcodes and spacers as if the FASTQ file had been produced by the DSWF procedure - amplification of sequence, attaching barcodes and spacers.

The DSWF procedure samples a certain number of amplified molecules from the source DNA sample. These are 'family' members. The procedure then separates each double stranded molecule and sequences each molecule multiple times. These are 'reads'. Each 'family' has a different barcode.

DSWFFakeFASTQ takes an input FASTA file. The entries in the FASTA file should be greater than the read length that you want DSWFFakeFASTQ to produce. Entries of 100 bp or less are sometimes difficult to match to the genome uniquely using bwa. It is recommended that you provide FASTA entries of 300 bp or more. If the sequence in the FASTA file is shorter than the read length desired, DSWFFakeFASTQ will pad the sequence with randomly generated sequence.

For each sequence in the FASTA file, DSWFFakeFASTQ randomly creates a number of molecules that will be sequenced as 'Num Families'. If you have two sequences in the FASTA file that contain the same sequence except for a SNP near the beginning of the sequence, seq1:C and seq1:T, DSWFFakeFASTQ will create a random number of 'families' for each sequence. It creates two reads for each sequence, one in each alignment pattern. As a hypothetical example, DSWFFakeFASTQ creates 2 families for seq1:C and 4 for seq1:T. Each family gets assigned a unique barcode. Then DSWFFakeFASTQ will create a random number of reads for each family. If DSWFFakeFASTQ creates 5 reads for family 1 of seq1:C with a barcode of AACAAGCAGT, then there will be 10 FASTQ entries for seq1:C with barcode AACAAGCAGT. If it creates 3 reads for family 2 of seq1:C with a barcode of GCGGCACATG, then there will be 6 FASTQ entries for seq1:C with a barcode of GCGGCACATG. The numbers of families and reads with associated barcodes are stored in a map_file.txt produced when DSWFFakeFASTQ is run. Depending on the options selected, the FASTQ header will include the FASTA file header and/or the barcode information for troubleshooting.

FASTA file:

>seq1:C GTGATAGAGTGGCATTAGAAATTCCAGATAGAGCTAAAACTGAAGCTTTCCTTATAGAGATTTATCCTAGTTAGTTTGCGGGGATACTGGTTGGGCCGAAATCCTTTTGAAACTGGTTAAAACTCTCAGGGGCCCTTCCATTTGGTTTTCTGCAGCTGTGGATTCCCAACCAACAGTCATTGTGATCTTCCAAGCCAGAATGTGCTCTGGGCTGGAGTGGCAGCCCCTTATTCTGGCATTCAAGAGCGTGGGCACCCTTTGGCTATTTCTAGCATTTGTCTGGTTAGCCTTTGGGAAACG

>seq1:T GTGATAGAGTGGCATTAGAAATTCCAGATAGAGCTAAAACTGAAGCTTTCCTTATAGAGATTTATCCTAGTTAGTTTGCGGGGATACTGGTTGGGCCGAAATCCTTTTGAAACTGGTTAAAACTCTCAGGGGCCCTTCCATTTGGTTTTCTGCAGCTGTGGATTCCCAACCAACAGTCATTGTGATCTTCCAAGCCAGAATGTGCTCTGGGCTGGAGTGGCAGCCCCTTATTCTGGCATTCAAGAGCGTGGGCACCCTTTGGCTATTTCTAGCATTTGTCTGGTTAGCCTTTGGGAAACG

Map file:

VERSION 0.06

FASTA Header Num Familes Num Reads Num Flipped Barcode A Barcode B Full Barcode

>seq1:C 2 4 2 AGAGGTCCCC AATTTGCTAA AGAGGTCCCCAATTTGCTAA

>seq1:C 2 4 2 GCCGCGCAGT GAAATCCAAT GCCGCGCAGTGAAATCCAAT

>seq1:T 4 8 4 TCTCGTTCCT GGTAAATCAC TCTCGTTCCTGGTAAATCAC

>seq1:T 4 7 3 CTGCAACTTA AACTGTCGAA CTGCAACTTAAACTGTCGAA

>seq1:T 4 4 2 TGAATAGATC TACTGTAGTA TGAATAGATCTACTGTAGTA

>seq1:T 4 4 2 ATTTACAGGG ACCCATTTTG ATTTACAGGGACCCATTTTG

The Num Families information is duplicated on every line and indicates the total number of lines of families for the FASTA sequence. The number of families generated depends on the max_num_families value. Each line should have a unique Barcode and a number of reads generated depending on the max_num_reads value. The Num Reads value will be duplicated because duplex sequencing requires ab and ba reads for each sequence to be valid. So the first barcode has 8 reads in seq1 and 8 in seq2

Run this example with: python makeFakeFASTQ.py --fasta simple.fa --max_num_families 4 --max_num_reads 8

It will produce four files:

DSWF_map.txt.gz A map file (see above) containing information on counts generated

DSWF_seq1.fastq.gz A FASTQ file of sequences

DSWF_seq2.fastq.gz A FASTQ file of sequence pairs

DSWF_tags.txt.gz A file mapping between the input FASTQ entry, the barcode, and the read names