Initial pass at full documentation for Conda-based dependency development.

docs/_writing_dependencies_docker.rst

@@ -0,0 +1,3 @@
+Dependencies and Docker
+===========================================
+

docs/_writing_using_seqtk.rst

@@ -7,9 +7,7 @@ install Seqtk - but however you obtain it should be fine.
 
 ::
 
-    $ conda config --add channels r
-    $ conda config --add channels bioconda
-    $ conda install seqtk
+    $ conda install -c bioconda seqtk=1.2
         ... seqtk installation ...
     $ seqtk seq
             Usage:   seqtk seq [options] <in.fq>|<in.fa>

docs/commands/conda_search.rst

@@ -0,0 +1,30 @@
+
+``conda_search`` command
+======================================
+
+This section is auto-generated from the help text for the planemo command
+``conda_search``. This help message can be generated with ``planemo conda_search
+--help``.
+
+**Usage**::
+
+    planemo conda_search [OPTIONS] TERM
+
+**Help**
+
+Perform conda search with Planemo's conda.
+
+Implicitly adds channels Planemo is configured with.
+
+**Options**::
+
+
+      --conda_prefix DIRECTORY        Conda prefix to use for conda dependency
+                                      commands.
+      --conda_exec PATH               Location of conda executable.
+      --conda_debug                   Enable more verbose conda logging.
+      --conda_channels, --conda_ensure_channels TEXT
+                                      Ensure conda is configured with specified
+                                      comma separated list of channels.
+      --help                          Show this message and exit.
+

docs/planemo.commands.rst

@@ -100,6 +100,14 @@ planemo.commands.cmd_conda_lint module
     :undoc-members:
     :show-inheritance:
 
+planemo.commands.cmd_conda_search module
+----------------------------------------
+
+.. automodule:: planemo.commands.cmd_conda_search
+    :members:
+    :undoc-members:
+    :show-inheritance:
+
 planemo.commands.cmd_config_init module
 ---------------------------------------
 
@@ -204,6 +212,14 @@ planemo.commands.cmd_normalize module
     :undoc-members:
     :show-inheritance:
 
+planemo.commands.cmd_open module
+--------------------------------
+
+.. automodule:: planemo.commands.cmd_open
+    :members:
+    :undoc-members:
+    :show-inheritance:
+
 planemo.commands.cmd_profile_create module
 ------------------------------------------
 

docs/planemo.reports.rst

@@ -12,6 +12,14 @@ planemo.reports.build_report module
     :undoc-members:
     :show-inheritance:
 
+planemo.reports.xunit_handler module
+------------------------------------
+
+.. automodule:: planemo.reports.xunit_handler
+    :members:
+    :undoc-members:
+    :show-inheritance:
+
 
 Module contents
 ---------------

docs/writing_advanced.rst

@@ -13,6 +13,7 @@ available - check out tutorial_ if you have never developed a Galaxy tool.
 .. include:: _writing_macros.rst
 .. include:: _writing_tool_metadata.rst
 .. include:: _writing_clusters.rst
+.. include:: _writing_dependencies_conda.rst
 
 .. _Galaxy: http://galaxyproject.org/
 .. _Docker: https://www.docker.com/

planemo/commands/cmd_conda_search.py

@@ -0,0 +1,26 @@
+"""Module describing the planemo ``conda_search`` command."""
+from __future__ import print_function
+
+import click
+
+from planemo import options
+from planemo.cli import command_function
+from planemo.conda import build_conda_context
+
+
+@click.command('conda_search')
+@options.conda_target_options()
+@click.argument(
+    "term",
+    metavar="TERM",
+    type=str,
+    nargs=1,
+)
+@command_function
+def cli(ctx, term, **kwds):
+    """Perform conda search with Planemo's conda.
+
+    Implicitly adds channels Planemo is configured with.
+    """
+    conda_context = build_conda_context(ctx, use_planemo_shell_exec=False, **kwds)
+    conda_context.exec_command("search", [term])

project_templates/conda_exercise/exercise_1/.shed.yml

@@ -0,0 +1,10 @@
+# repository published to https://toolshed.g2.bx.psu.edu/repos/iuc/pear
+owner: planemo
+name: pear
+description: PEAR evaluates all possible paired-end read overlaps
+long_description: |
+  PEAR evaluates all possible paired-end read overlaps and without requiring the target fragment size as input. In addition, it implements a statistical test for 
+  minimizing false-positive results. Together with a highly optimized implementation, it can merge millions of paired end reads within a couple of minutes on a 
+  standard desktop computer. Repository-Maintainer: Björn Grüning
+remote_repository_url: https://github.com/galaxyproject/planemo/tree/master/project_templates/conda_exercise/exercise_1
+

project_templates/conda_exercise/exercise_1/pear.xml

@@ -0,0 +1,165 @@
+<tool id="iuc_pear" name="Pear" version="0.9.6.1">
+    <description>Paired-End read merger</description>
+    <stdio>
+        <exit_code range="1:" />
+        <exit_code range=":-1" />
+        <regex match="Error:" />
+        <regex match="Exception:" />
+    </stdio>
+    <command>
+<![CDATA[
+    pear
+        #if str( $library.type ) == "paired":
+            -f "$library.forward"
+            -r "$library.reverse"
+            #if $library.forward.is_of_type( 'fastqillumina' ):
+                --phred-base 64
+            #else:
+                --phred-base 33
+            #end if
+        #else
+            ## prepare collection
+            -f "$library.input_collection.forward"
+            -r "$library.input_collection.reverse"
+            #if $library.input_collection.forward.is_of_type( 'fastqillumina' ):
+                --phred-base 64
+            #else:
+                --phred-base 33
+            #end if
+        #end if
+
+        --output pear
+        --p-value $pvalue
+        --min-overlap $min_overlap
+        #if int($max_assembly_length) > 0:
+            --max-asm-length $max_assembly_length
+        #end if
+        --min-asm-length $min_assembly_length
+        --min-trim-length $min_trim_length
+        --quality-theshold $quality_threshold
+        --max-uncalled-base $max_uncalled_base
+        --test-method $test_method
+        --empirical-freqs $empirical_freqs
+        -j "\${GALAXY_SLOTS:-8}"
+        --score-method $score_method
+        --cap $cap
+        $nbase
+]]>
+    </command>
+    <inputs>
+        <conditional name="library">
+            <param name="type" type="select" label="Dataset type">
+              <option value="paired">Paired-end</option>
+              <option value="paired_collection">Paired-end Dataset Collection</option>
+            </param>
+            <when value="paired">
+                <param name="forward" type="data" format="fastqillumina,fastqsanger"
+                    label="Name of file that contains the forward paired-end reads" help="-f" />
+                <param name="reverse" type="data" format="fastqillumina,fastqsanger"
+                    label="Name of file that contains the reverse paired-end reads" help="-r" />
+            </when>
+            <when value="paired_collection">
+                <param name="input_collection" format="fastqillumina,fastqsanger"
+                    type="data_collection" collection_type="paired"
+                    label="FASTQ Paired Dataset" help="Nucleotide-space: Must have PHRED-scaled quality values. (-f and -r)" />
+            </when>
+        </conditional>
+
+        <!-- optional -->
+        <param name="pvalue" type="float" value="0.01" min="0" optional="True" max="1" label="Specify a p-value for the statistical test"
+            help="If the computed p-value of a possible assembly exceeds the specified p-value then the paired-end read will not be assembled. Setting 1.0 disables the test. (--p-value)" />
+
+        <param name="min_overlap" type="integer" value="10" optional="True" label="Minimum overlap size"
+            help="The minimum overlap may be set to 1 when the statistical test is used. However, further restricting the minimum overlap size to a proper value may reduce false-positive assembles. (--min-overlap)" />
+
+        <param name="max_assembly_length" type="integer" value="0" optional="True" label="Maximum possible length of the assembled sequences"
+            help="Setting this value to 0 disables the restriction and assembled sequences may be arbitrary long. (--max-assembly-length)" />
+
+        <param name="min_assembly_length" type="integer" value="50" optional="True" label="Minimum possible length of the assembled sequences"
+            help="Setting this value to 0 disables the restriction and assembled sequences may be arbitrary short. (--min-assembly-length)" />
+
+        <param name="min_trim_length" type="integer" value="1" optional="True" label="Minimum length of reads after trimming the low quality part"
+            help="See option -q. (--min-trim-length)" />
+
+        <param name="quality_threshold" type="integer" value="0" optional="True" label="Quality score threshold for trimming the low quality part of a read"
+                help="If the quality scores of two consecutive bases are strictly less than the specified threshold, the rest of the read will be trimmed. (--quality-threshold)" />
+
+        <param name="max_uncalled_base" type="float" value="1.0" min="0" optional="True" max="1" label="Maximal proportion of uncalled bases in a read"
+            help="Setting this value to 0 will cause PEAR to discard all reads containing uncalled bases. The other extreme setting is 1 which causes PEAR to process all reads independent on the number of uncalled bases. (--max-uncalled-base)" />
+
+        <param name="cap" type="integer" value="40" optional="True" label="Specify  the upper bound for the resulting quality score"
+            help="If set to zero, capping is disabled. (--cap)" />
+
+        <param name="test_method" type="select" label="Type of statistical test" help="(--test-method)">
+            <option value="1" selected="True">Given the minimum allowed overlap, test using the highest OES (1)</option>
+            <option value="2">Use the acceptance probability (2)</option>
+        </param>
+
+        <param name="empirical_freqs" type="boolean" truevalue="-e" falsevalue="" checked="false"
+            label="Disable empirical base frequencies" help="(--empirical-freqs)" />
+        <param name="nbase" type="boolean" truevalue="--nbase" falsevalue="" checked="false"
+            label="Use N base if uncertain" help="When  merging a base-pair that consists of two non-equal bases out of which none is degenerate, set the merged base to N and use the highest quality score of the two bases. (--nbase)" />
+
+        <param name="score_method" type="select" label="Scoring method" help="(--score-method)">
+            <option value="1">OES with +1 for match and -1 for mismatch</option>
+            <option value="2" selected="True">Assembly score (AS) use +1 for match and -1 for mismatch multiplied by base quality scores</option>
+            <option value="3">Ignore quality scores and use +1 for a match and -1 for a mismatch</option>
+        </param>
+
+        <param name="outputs" type="select" display="checkboxes" optional="False" multiple="True" label="Output files">
+            <option value="assembled" selected="True">Assembled reads</option>
+            <option value="forward">Forward unassembled reads</option>
+            <option value="reverse">Reverse unassembled reads</option>
+            <option value="discarded">Discarded reads</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data format="input" name="assembled_reads" from_work_dir="pear.assembled.fastq" label="${tool.name} on ${on_string}: Assembled reads">
+            <filter>'assembled' in outputs</filter>
+        </data>
+        <data format="input" name="unassembled_forward_reads" from_work_dir="pear.unassembled.forward.fastq" label="${tool.name} on ${on_string}: Unassembled forward reads">
+            <filter>'forward' in outputs</filter>
+        </data>
+        <data format="input" name="unassembled_reverse_reads" from_work_dir="pear.unassembled.reverse.fastq" label="${tool.name} on ${on_string}: Unassembled reverse reads">
+            <filter>'reverse' in outputs</filter>
+        </data>
+        <data format="input" name="discarded_reads" from_work_dir="pear.discarded.fastq" label="${tool.name} on ${on_string}: Discarded reads">
+            <filter>'discarded' in outputs</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="forward" value="forward.fastq" ftype="fastqsanger" />
+            <param name="reverse" value="reverse.fastq" ftype="fastqsanger" />
+            <param name="min_overlap" value="10" />
+            <param name="min_assembly_length" value="50" />
+            <param name="cap" value="0" />
+            <param name="outputs" value="assembled,forward" />
+            <output name="assembled_reads" file="pear_assembled_results1.fastq" ftype="fastqsanger"/>
+            <output name="unassembled_forward_reads" file="pear_unassembled_forward_results1.fastq" ftype="fastqsanger"/>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+
+**What it does**
+
+PEAR_ is an ultrafast, memory-efficient and highly accurate pair-end read merger.
+PEAR evaluates all possible paired-end read overlaps and without requiring the target fragment
+size as input. In addition, it implements a statistical test for minimizing false-positive results.
+Together with a highly optimized implementation, it can merge millions of paired end reads within a couple of minutes
+on a standard desktop computer.
+
+For more information please look at the documentation_ and `github repository`_.
+
+.. _PEAR: http://sco.h-its.org/exelixis/web/software/pear/
+.. _documentation: http://sco.h-its.org/exelixis/web/software/pear/doc.html
+.. _github repository: https://github.com/xflouris/PEAR
+
+
+]]>
+  </help>
+  <citations>
+      <citation type="doi">10.1093/bioinformatics/btt593</citation>
+  </citations>
+</tool>

project_templates/conda_exercise/exercise_1/test-data/forward.fastq

@@ -0,0 +1,56 @@
+@EU861894-140/1
+CAACCATTCCACTCGCCTCTGCCGCACTCGAGGCCCCCAGTATGAGAGGCAGTTACGAGGTTGAACCTCAGAATCTCACCCCACACTTAAGGGCGCGCCT
++
+@#CAAF4FHFG;DIJJI?JG#GIIIDECD#4H*1IBIIIH#?IDID*DFIIF?C#HGBJICJBC#JEGEA>ECH#=7#DDF@##D#D<@C#CC@#C?D@,
+@EU861894-138/1
+TCCGAGGTTGAGCCTCAGAATTTCACCCCCCACTTAACGGCCCGACTCCGCGCTCCTTACGCCCAGTAAGTTCGGACAACGCTGGCCCCCTACGTACTAC
++
+@CCFFFBFFDHFHJJJ+<HJJGIGGBJJIDJ?JIJII#I5D*GB#EJ#FEJEIEI#GG#AIIDIEAD?@#AD3HG3;E;D7##FCDH0?#A,DD#A#ADA
+@EU861894-136/1
+GCTGATCGTCCTCTCAGACCACCTACCCGTCAAAGCCTTGGTGCGACGTAACTCCCCCAACTAGACGATAGGCCAAGGGCCTATCCCGAAGTGCCCGAAG
++
+@@C?F;FF#HGHGJC<JJJC<#CJG61GHIE#?J:JJHJJHFJ#?#1JJ#<J(DHFEIJJD=JF##DIECH)GD(#D<HC>#C@B9DEFDD@ED#EDBD>
+@EU861894-134/1
+TTGTGCAAGAGTCCTAATTGCTGCCCCCCGTAGGAGTCTGGGCCGTATCTCAGTCCCAATCCGGCTGTTCGTCCCCTCAGACCATGTACCCGTAGATGCC
++
+=CCFDFFFA?#BHIJJJCIJ<JIJIGHJ8JHCI9JJIDJIGIJEFI9@JIJ#FFI5J>JJJD;EEJB#@2GFIE#>A;C@FCA@##BD>AD=D#D?##A,
+@EU861894-132/1
+CGGAACACCCATGGCGAAGGCAGCTCGCTGGCCTGCAACTGACCCTGAGGCGCAAAAGCCGGGGGATCAAACAGGTTTATATACCCTGGTAGTCCCGAGC
++
+CCC4FFDFFFHH#AIJ<EJJJGGJJJJJIHEGE@GIIIBJ#JJ##GJ8IG#IJFHICFH#JJC?8I#HD;GD#ED#<B;##>DEDBC#H;#E8A(?>##D
+@EU861894-130/1
+TCGTCACTAACCGAAGAACCTTACCAGGGTTTGACATCCCCGGCCAGCACGAGAGATCGGGTGGTGCCCGCAAGGGGACCGGGTGACAGGTGTTGACTAG
++
+:B@FDFDFH<HAFIGFJJJ7JHJHJGFJHJJHHD?JBHIII1J#IAEI#7IIGFAEJGBCEAI#E#IHECC>CA@:CDFDEDAA#DDF:-<DA#D##CDD
+@EU861894-128/1
+CGGCTAACTACGTGCCAGCAGCCGCGGTTATACGTAGGGGGCCAGCGTTGTCCGTAGTTACCGGGAGTTAAGAGCGCGTAGCCAGGCCATTAAGTGGGGG
++
+@C?BFFFD#9HAHHHIJDJIJ<IJJJAB#GHFJJHGG*JG=IHI9#FJBDGBE8#B)@E7G#DFH##6#HD<D8IC;ACCD#D#;DA?#DACDE<CE>D,
+@EU861894-126/1
+GGAATGGTCGGTGTAGCGGTGAAATGCGTAGATATCGATCGGAACACCCATGGCTAAGGTAGCTTGCTGGCGTGCAACAGACGCTCAGGCGCAAAAGCCG
++
+BC?#FF=FBFHHHFGIGEIJ@IJJIFI@HJI9IJ;GHBGIIJG<CJIH8AEBI@#DGHF#G;)A#>HDC<>#9E7@CG#D(BHED#=;CD:;#>C#C?B,
+@EU861894-124/1
+CTGTGCCGCAGCTAACCCAAAAAGTATTCCGCCTGGGGAGTACGGCCGCAAGGTTGAAACTCAACGGAATTGACGGGGAACCGCACAAGCGGTGGACCAT
++
+CCCFFFFD,GB<CEI@#<I##JJG<HG<IBGFJ#DHI3IIHJII@GJAGGBGD#JEGBG'EJDB!HIEHE@AD#.DC###C<CF?C@DDFF?D@CD#BB,
+@EU861894-122/1
+TACACCGACCATTCCACTCGCCTCTCCCGCACTCAAGGCCCCCAGTATGATAGGCAGTTCCGAGGTTGAGCCTCAGAATTTCACCCCCCACTTAAGTGTC
++
+B@@D=F2FHDFHFJJJIJ#JI@JHJGJJJEIHI0JIJJHG3JAGHJ@BIA!FDIJA#H2J#HDFH?@G)H;;EBD=@FC3#CCB>BD@8D>:BDD<###,
+@EU861894-120/1
+CTGTCACCCGGTCCGCTTGCGGGGAACACCCGATCTCTCGCGCTGTCCGGGGATGTCAAACCCTGGTAATGTTCTTCCGTTAGTGACGAATTAATGCAGA
++
+@C@FAFFFAHHHFA#JJ#J:IJ?H:HJJH9IJ#9I?IG:J#*IEBIC;I?AEJDIJJHHCICCHDJJ;C##C2EF?B#C>?DD6(B+#(D@E:DCDCC#,
+@EU861894-118/1
+CGAGCGCAACCCTGACCCAATGTTGGCAGCGTAAAGTCGGCAACTCTTTGGGAACTGCCCGTGGAAGCGGGAGGAAGGTGGGGATGACGTCAAATAGGCA
++
+@?;FF?EFFHHHH#HEAIGJ@J1JIJIJJGDGIF7GGH=J#JGIJJ#:GFJID#FJJ#JID4?#DBDJHEFID;EA5EDD;C?CCDCBDA>:CB>#DD#C
+@EU861894-116/1
+GAGGCAGTTCCGAGGTTGAGCCTCAGAATTTCACCCCCCACTTAAGGGCCCGCCTACGCCCTATTTACGCCCATTAAATTCGGACAACGCTGGCCGCCTA
++
+C@@FFFD2GHHFFICFAGJJI3JJIIII8II#<*JJH#JJIID(EGEGJ;GE@D7IJHF#B;#C?H@GH;FCI#D<C#EA(>D@DE6CCDCDDC<#ACD4
+@EU861894-114/1
+TTACTAGGGATTCCGGCTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGACCATATTTGTGCGATTGGCTCCTCTACGCGGCATAGCGTCGCGC
++
+@C:FFDD#BHHAAIJ(GIFGIJGHBHDI9ICHGE7JHEJI4IJBBIDIAHJIBCBFIF#J=BDFFDD8HCHJ8E:@@C#D##BA@DD5=E#A5B#D#B#F