A command line interface for designing bridge RNAs for bridge editing. Accompanies the papers "Bridge RNAs direct modular and programmable recombination of target and donor DNA", Durrant & Perry et al. (2024), and "Megabase-scale human genome rearrangement with programmable bridge recombinases", Perry et al. (2025).
- Tested on python 3.8
- Tested on Linux and Mac
pip install bridgernadesignerCommand to design a bridge RNA for a given target and donor sequence, and a bridge RNA scaffold.
brna-design --target ATCAGGCCTACGTC --donor ACAGTATCTTGTAT --scaffold ISCro4_enhancedExample output:
>BridgeRNA_tgt_ATCAGGCCTACGTC_dnr_ACAGTATCTTGTAT_scaffold_ISCro4_enhanced
AGTGCAGGGAGAACCGGCCAGTTCTCTCTGCCATGCGGTCCGCATGCCGTATCAGGCCTTGGGCTAATAACCCGTGACGTAGATTGGCAGCGGACCGCGCCGTTCTCCACAAGTGACAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGCATTCACAAGGCTGGTCTCACTTGTGGAGAACG
>BridgeRNA_tgt_ATCAGGCCTACGTC_dnr_ACAGTATCTTGTAT_scaffold_ISCro4_enhanced_split_tbl
AGTGCAGGGAGAACCGGCCAGTTCTCTCTGCCATGCGGTCCGCATGCCGTATCAGGCCTTGGGCTAATAACCCGTGACGTAGATTGGCAGCGGACCGC
>BridgeRNA_tgt_ATCAGGCCTACGTC_dnr_ACAGTATCTTGTAT_scaffold_ISCro4_enhanced_split_dbl
CGTTCTCCACAAGTGACAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGCATTCACAAGGCTGGTCTCACTTGTGGAGAACGThis should run very quickly on a Mac or Linux machine. There is also an option to output the sequence in Stockholm format with multiple tracks.
brna-design --target ATCAGGCCTACGTC --donor ACAGTATCTTGTAT --scaffold ISCro4_enhanced -of stockholm# STOCKHOLM 1.0
BridgeRNA_tgt_ATCAGGCCTACGTC_dnr_ACAGTATCTTGTAT_scaffold_ISCro4_enhanced AGTGCAGGGAGAACCGGCCAGTTCTCTCTGCCATGCGGTCCGCATGCCGTATCAGGCCTTGGGCTAATAACCCGTGACGTAGATTGGCAGCGGACCGCGCCGTTCTCCACAAGTGACAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGCATTCACAAGGCTGGTCTCACTTGTGGAGAACG
#=GC bRNA_template AGTGCAGGGAGAACCGGCCAGTTCTCTCTGCCATGCGGTCCGCATGCCGTNNNNNNNNNTGGGCTAATAACCCGTNNNNNNNNNTGGCAGCGGACCGCGCCGTTCTCCACAAGTGACAAACCGGNNNNNNNNATGGACCGGTTTTCCCGGTAATCCGCNNTCNNNNNNNTGGTCTCACTTGTGGAGAACG
#=GC guides ..................................................LLLLLLLCC................RRRRRCCHH........................................lllllllc..........................rr..rrrcchh.....................
//In the #=GC guides track, the L character indicates the programmable nucleotides of the LTG, the R character
indicates the programmable nucleotides of the RTG, the C character indicates the guide nucleotides of the
target core, the H character indicates the position of the programmable handshake guide nucleotides, the
l character indicates the programmable nucleotides of the LDG, the r character
indicates the programmable nucleotides of the RDG, the c character indicates the guide nucleotides of the
donor core, and the h character indicates the position of the programmable handshake guide nucleotides.
Please cite the linked publications above if you use any aspect of this code in your work.