Toxinotype assignment of Clostridium perfringens via ABRicate. C. perfringens has 7 toxinotypes (i.e. A-G) based on the different combinations of toxin genes. A validated/published toxin gene database is included in this repository.
- ABRicate v1.0.1 and its dependencies (will be available using Conda)
Please refer to this section in ABRicate github page: https://github.com/tseemann/abricate#making-your-own-database
$ TOXIper.sh -h
This bash script assigns toxinotypes to C. perfringens genome assemblies using ABRicate v1.0.1 (type will be shown on stdout)
Dependency: ABRicate v1.0.1 with toxinCP database
Usage: ./TOXIper.sh [options] FASTAFILE
Option:
-h print usage and exit
-a print author and exit
-v print version and exit
Version 1.1
Author: Raymond Kiu Raymond.Kiu@quadram.ac.uk (2020)
A C. perfringens genome assembly in multi-fasta format. One at a time. To give you an idea what a multi-fasta format is:
>Contig1
ATTCGCGAAAGGCCCCCCTTTG
ATGGGGTGTGCCCCCGGTGTGT
It will not work on bugs other than C. perfringens as genes will not be detected.
Toxinotype (e.g. B) will be printed on the stdout
$ TOXIper.sh CP-21.fna
B
ABRicate BLASTn cutoffs will be set at default, which is minimum nucleotide identity >80% and minimum coverage >80%.
Use > to save outcome into a new file, for example (can be any file name you like)
$ TOXIper.sh CP-21.fna > CP-21.toxinotype
Please report bugs at the issues page so I can respond.
- Please cite this paper if you used the toxin sequence database for toxinotyping.
- Also cite ABRicate as a dependency.
If you use TOXIper for results in your publication, please cite:
- Kiu R, TOXIper: rapid toxinotyping of Clostridium perfringens genomes, GitHub
https://github.com/raymondkiu/TOXIper
Raymond Kiu Raymond.Kiu@quadram.ac.uk